Stem-loop sequence bta-mir-2284y-7

AccessionMI0022317 (change log)
DescriptionBos taurus miR-2284y-7 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284y-7
(33 sentences)

Stem-loop
   -     a      a    c                 cc 
5'  ggguu gccaaa aguu guucggguuuuuccgua  c
    ||||| |||||| |||| |||||||||||||||||   
3'  ccuaa cgguuu ucaa caaguucgaaaagguau  g
   a     c      c    a                 ac 
Get sequence
Deep sequencing
71346 reads, 427 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 60786220-60786296 [+]
sense
ENSBTAT00000054821 ; STK32A-201; intron 6
Database links

Mature sequence bta-miR-2284y

Accession MIMAT0024579
Sequence

11 - 

aaaaguucguucggguuuuuc

 - 31

Get sequence
Deep sequencing491587 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).