Stem-loop sequence bta-mir-6526-2

AccessionMI0022314 (change log)
DescriptionBos taurus miR-6526-2 stem-loop
Gene family MIPF0001431; mir-6526
Literature search

3 open access papers mention bta-mir-6526-2
(3 sentences)

Stem-loop
   g  u  ag    c         -   ug   uu   gua 
5'  ug gc  ugcc ugcccauuc agg  cag  cau   c
    || ||  |||| ||||||||| |||  |||  |||   a
3'  ac cg  augg auggguaag ucc  guc  gug   a
   -  u  ga    u         c   gu   cu   guu 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 30460604-30460682 [+]
intergenic
Database links

Mature sequence bta-miR-6526

Accession MIMAT0025556
Sequence

48 - 

uccugugccucgaauggguaug

 - 69

Get sequence
Deep sequencing213 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).