Stem-loop sequence bta-mir-3660

AccessionMI0022308 (change log)
DescriptionBos taurus miR-3660 stem-loop
Gene family MIPF0001397; mir-3660
Stem-loop
   cug                 a        u  - g   g 
5'    gacaaaguuaaaaugcu uucuguca ug u aua u
      ||||||||||||||||| |||||||| || | ||| u
3'    cuguuuuaauuuuacga aggacagu ac g uau c
   gaa                 g        c  g g   a 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 92314258-92314337 [-]
sense
ENSBTAT00000063358 ; bta-mir-3660-201; exon 1
Database links

Mature sequence bta-miR-3660

Accession MIMAT0025555
Sequence

50 - 

acugacaggagagcauuuuaa

 - 70

Get sequence
Deep sequencing36 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).