Stem-loop sequence bta-mir-6525

AccessionMI0022304 (change log)
DescriptionBos taurus miR-6525 stem-loop
Literature search

1 open access papers mention bta-mir-6525
(8 sentences)

Stem-loop
   -   ---c    a   ---             g     g c   ac 
5'  ggc    gggg gcu   ggggaaagcagga ugagg u ugc  c
    |||    |||| |||   ||||||||||||| ||||| | |||   
3'  ccg    cccc cgg   ccccuuucgucuu gcucc a aug  c
   c   uacu    a   aca             -     g -   ac 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 114868041-114868125 [-]
sense
ENSBTAT00000043835 ; FASTK-201; exon 6
ENSBTAT00000014911 ; FASTK-202; exon 6
Database links

Mature sequence bta-miR-6525

Accession MIMAT0025554
Sequence

11 - 

cuggggaaagcaggagugag

 - 30

Get sequence
Deep sequencing45 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).