Stem-loop sequence bta-mir-6524

AccessionMI0022302 (change log)
DescriptionBos taurus miR-6524 stem-loop
Literature search

2 open access papers mention bta-mir-6524
(5 sentences)

Stem-loop
   a       c          cc            uau    a 
5'  acaagga accaguuagg  acucagaguaac   cagu a
    ||||||| ||||||||||  ||||||||||||   |||| c
3'  uguuccu uggucaaucc  ugagucucauug   guca u
   -       a          aa            ---    a 
Get sequence
Deep sequencing
2859 reads, 14.9 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 31908077-31908157 [+]
sense
ENSBTAT00000025886 ; PDCD4-201; intron 5
Database links

Mature sequence bta-miR-6524

Accession MIMAT0025553
Sequence

51 - 

uuacucugaguaaccuaacug

 - 71

Get sequence
Deep sequencing2856 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).