Stem-loop sequence bta-mir-6523a

AccessionMI0022301 (change log)
Previous IDsbta-mir-6523
DescriptionBos taurus miR-6523 stem-loop
Stem-loop
   -      aa  u      ua   uu        g     uu 
5'  acucug  cu cugggg  acu  gagcaggg augaa  g
    ||||||  || ||||||  |||  |||||||| |||||   
3'  ugagac  gg gacccc  uga  cucguccc uacuu  u
   a      gg  u      ug   -u        a     ua 
Get sequence
Deep sequencing
293 reads, 1.59 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 46294907-46294988 [-]
sense
ENSBTAT00000016012 ; EPG5-201; intron 9
Clustered miRNAs
< 10kb from bta-mir-6523a
bta-mir-6523bchr24: 46294919-46294977 [+]
bta-mir-6523achr24: 46294907-46294988 [-]
Database links

Mature sequence bta-miR-6523a

Accession MIMAT0025552
Previous IDsbta-miR-6523
Sequence

11 - 

ucugggguaacuuugagcaggg

 - 32

Get sequence
Deep sequencing293 reads, 63 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).