Stem-loop sequence bta-mir-378c

AccessionMI0022299 (change log)
DescriptionBos taurus miR-378c stem-loop
Literature search

24 open access papers mention bta-mir-378c
(103 sentences)

Stem-loop
   caaaacca       ----   u   g   g agu 
5'         ccacugg    acu gga uca a   u
           |||||||    ||| ||| ||| |   c
3'         ggugacc    ugg ucu agu u   c
   aaucguua       ggga   u   g   g gua 
Get sequence
Deep sequencing
599159 reads, 4.71e+03 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 31823795-31823863 [-]
antisense
ENSBTAT00000048222 ; ZNF521-201; intron 2
Database links

Mature sequence bta-miR-378c

Accession MIMAT0025551
Sequence

11 - 

acuggacuuggagucagaagu

 - 31

Get sequence
Deep sequencing599159 reads, 78 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).