Stem-loop sequence bta-mir-2285o-3

AccessionMI0022296 (change log)
DescriptionBos taurus miR-2285o-3 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285o-3
(15 sentences)

   g           a    a                    ag 
5'  uuaggugggcc aaaa uuuguuuggguuuuucugua  a
    ||||||||||| |||| ||||||||||||||||||||   
3'  aauccacccgg uuuu aagcaagcccaaaaagguau  u
   -           g    c                    gg 
Get sequence
Deep sequencing
4112 reads, 14.5 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 33986931-33987011 [+]
ENSBTAT00000008875 ; RBBP8-201; intron 14
Clustered miRNAs
< 10kb from bta-mir-2285o-3
bta-mir-2285o-3chr24: 33986931-33987011 [+]
bta-mir-2284y-4chr24: 33986933-33987009 [-]
Database links

Mature sequence bta-miR-2285o

Accession MIMAT0025530

52 - 


 - 71

Get sequence
Deep sequencing17940 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets


PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).