Stem-loop sequence bta-mir-1247

AccessionMI0022295 (change log)
DescriptionBos taurus miR-1247 stem-loop
Gene family MIPF0000669; mir-1247
Literature search

3 open access papers mention bta-mir-1247
(4 sentences)

Stem-loop
   -c  -       a  c      u    c     acguc  u 
5'   gc cgggcgc cc gucccg gcgu cccgg     gc g
     || ||||||| || |||||| |||| |||||     || u
3'   cg gcccgcg gg cagggc ugca gggcc     cg c
   gu  c       a  u      -    a     ----c  u 
Get sequence
Deep sequencing
461 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 68426259-68426336 [-]
sense
ENSBTAT00000057495 ; bta-mir-1247-201; exon 1
Database links

Mature sequence bta-miR-1247-5p

Accession MIMAT0025549
Sequence

11 - 

acccgucccgugcguccccgga

 - 32

Get sequence
Deep sequencing455 reads, 57 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-1247-3p

Accession MIMAT0025550
Sequence

48 - 

cgggaacgucgggacuggagc

 - 68

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).