Stem-loop sequence bta-mir-3957

AccessionMI0022294 (change log)
DescriptionBos taurus miR-3957 stem-loop
Gene family MIPF0001605; mir-3957
Literature search

1 open access papers mention bta-mir-3957
(1 sentences)

Stem-loop
   u   u          a   u ca      - -     ag 
5'  ugg gggagcucgg gag g  gcugug g guguc  g
    ||| |||||||||| ||| |  |||||| | |||||  g
3'  acc uccucgaguc cuc c  cgacac c cacgg  u
   a   u          a   - -a      g a     ac 
Get sequence
Deep sequencing
256 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67881103-67881179 [+]
sense
ENSBTAT00000064979 ; bta-mir-3957-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3957
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-3957

Accession MIMAT0025548
Sequence

11 - 

cucggagagugcagcugugg

 - 30

Get sequence
Deep sequencing160 reads, 46 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).