Stem-loop sequence bta-mir-154b

AccessionMI0022293 (change log)
DescriptionBos taurus miR-154b stem-loop
Gene family MIPF0000018; mir-154
Literature search

10 open access papers mention bta-mir-154b
(53 sentences)

Stem-loop
   --                 uu     -   c     - uuua 
5'   guacuugaagagagguc  ccaug gug auucg c    u
     |||||||||||||||||  ||||| ||| ||||| |     
3'   uauggauuuuuuuccag  gguac uac uaagc g    u
   ac                 uu     a   -     a uuuc 
Get sequence
Deep sequencing
1038 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67876730-67876810 [+]
sense
ENSBTAT00000065663 ; bta-mir-154b-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-154b
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-154b

Accession MIMAT0025547
Sequence

11 - 

agaggucuuccauggugcauucg

 - 33

Get sequence
Deep sequencing828 reads, 60 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).