Stem-loop sequence bta-mir-411c

AccessionMI0022292 (change log)
DescriptionBos taurus miR-411c stem-loop
Gene family MIPF0000126; mir-379
Literature search

1 open access papers mention bta-mir-411c
(1 sentences)

Stem-loop
   ---     u    g  u      aga         uug 
5'    gggag ggau gu gaucag   acauacauu   u
      ||||| |||| || ||||||   |||||||||    
3'    cccuc ccug ca cuaguc   uguauguag   c
   uau     -    a  c      aac         uaa 
Get sequence
Deep sequencing
5516 reads, 22.2 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67867851-67867924 [+]
sense
ENSBTAT00000065169 ; bta-mir-411c-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-411c
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
Database links

Mature sequence bta-miR-411c-5p

Accession MIMAT0025545
Sequence

11 - 

gguugaucagagaacauacauu

 - 32

Get sequence
Deep sequencing5051 reads, 63 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-411c-3p

Accession MIMAT0025546
Sequence

43 - 

uguaugucaacugauccacagu

 - 64

Get sequence
Deep sequencing465 reads, 59 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).