Stem-loop sequence bta-mir-3956

AccessionMI0022291 (change log)
DescriptionBos taurus miR-3956 stem-loop
Gene family MIPF0001577; mir-3956
Stem-loop
   g  ---    --   u      -u             aagugcuucugucu 
5'  cc   aggu  acg ggaugc  gaaggucagaggg              g
    ||   ||||  ||| ||||||  |||||||||||||              c
3'  gg   ucua  ugc ccuacg  cuuccagucuccu              a
   a  auc    cu   -      uc             gaccucuuguguac 
Get sequence
Deep sequencing
424 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67860482-67860579 [+]
sense
ENSBTAT00000065642 ; bta-mir-3956-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3956
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
Database links

Mature sequence bta-miR-3956

Accession MIMAT0025544
Sequence

8 - 

acguggaugcugaaggucagagg

 - 30

Get sequence
Deep sequencing109 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).