Stem-loop sequence bta-mir-376e

AccessionMI0022290 (change log)
DescriptionBos taurus miR-376e stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention bta-mir-376e
(1 sentences)

Stem-loop
   u      c    g      a     u         - a ga 
5'  gauauu aaaa guggau uuccu cuauguuua c g  u
    |||||| |||| |||||| ||||| ||||||||| | |   
3'  cuauga uuuu caccua aagga gauacaaau g c  u
   u      a    a      a     -         c a ag 
Get sequence
Deep sequencing
1414 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67856314-67856395 [+]
sense
ENSBTAT00000065744 ; bta-mir-376e-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-376e
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
Database links

Mature sequence bta-miR-376e

Accession MIMAT0025543
Sequence

51 - 

aacauagaggaaaauccacauu

 - 72

Get sequence
Deep sequencing1356 reads, 64 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).