Stem-loop sequence bta-mir-154c

AccessionMI0022289 (change log)
DescriptionBos taurus miR-154c stem-loop
Gene family MIPF0000018; mir-154
Literature search

10 open access papers mention bta-mir-154c
(66 sentences)

Stem-loop
   ---uuc            u     au         uua 
5'       gaaaggagguug ccgug  guauuugcu   u
         |||||||||||| |||||  |||||||||    
3'       cuuuucucuagu ggcac  uauagacgg   u
   cuacuu            u     gu         ugu 
Get sequence
Deep sequencing
7675 reads, 40.6 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67853625-67853699 [+]
sense
ENSBTAT00000065637 ; bta-mir-154c-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-154c
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
Database links

Mature sequence bta-miR-154c

Accession MIMAT0025542
Sequence

44 - 

agauauugcacgguugaucucu

 - 65

Get sequence
Deep sequencing7648 reads, 64 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).