Stem-loop sequence bta-mir-411b

AccessionMI0022288 (change log)
DescriptionBos taurus miR-411b stem-loop
Gene family MIPF0000126; mir-379
Literature search

2 open access papers mention bta-mir-411b
(2 sentences)

Stem-loop
   -   g     a    c      aaa        gugc 
5'  ugu gagag uggu gaccau   acguacgu    u
    ||| ||||| |||| ||||||   ||||||||     
3'  acg cucuu auca cuggua   uguaugca    u
   u   a     a    c      cac        guau 
Get sequence
Deep sequencing
1109 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67843330-67843404 [+]
sense
ENSBTAT00000063816 ; bta-mir-411b-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-411b
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
Database links

Mature sequence bta-miR-411b

Accession MIMAT0025541
Sequence

11 - 

uggucgaccauaaaacguacgu

 - 32

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).