Stem-loop sequence bta-mir-6522

AccessionMI0022287 (change log)
DescriptionBos taurus miR-6522 stem-loop
Stem-loop
   -           c                c  uuuu 
5'  auguguguacu ggaauuguuuguguac ug    c
    ||||||||||| |||||||||||||||| ||    a
3'  uacacacauga ccuuaacaaacacaug ac    a
   g           a                a  cuua 
Get sequence
Deep sequencing
460 reads, 2.9 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 44010732-44010805 [+]
intergenic
Database links

Mature sequence bta-miR-6522

Accession MIMAT0025540
Sequence

11 - 

ucggaauuguuuguguaccugu

 - 32

Get sequence
Deep sequencing456 reads, 69 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).