Stem-loop sequence bta-mir-6521

AccessionMI0022283 (change log)
DescriptionBos taurus miR-6521 stem-loop
Stem-loop
   u    g  u     g      c u  --     u     g gu    
5'  gcac uc gcacu ugcuca g gu  gugcc gccga u  uga 
    |||| || ||||| |||||| | ||  ||||| ||||| |  || u
3'  ugug gg uguga acgagu c cg  cgcgg uggcu g  acu 
   -    g  u     g      - u  ac     -     a ug    
Get sequence
Deep sequencing
105 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 67144520-67144607 [-]
intergenic
Database links

Mature sequence bta-miR-6521

Accession MIMAT0025539
Sequence

56 - 

guggcgccagcucugagcagagu

 - 78

Get sequence
Deep sequencing102 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).