Stem-loop sequence bta-mir-6520

AccessionMI0022282 (change log)
DescriptionBos taurus miR-6520 stem-loop
Stem-loop
   gucc  -  cc        u u a      g      --u  g 
5'     cu cu  uugaguau g c gagaga cgauuc   gu c
       || ||  |||||||| | | |||||| ||||||   ||  
3'     ga ga  gacucaug c g cucucu gcugag   ca c
   ccgc  c  cc        u c c      -      ucc  c 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 46216414-46216497 [-]
sense
ENSBTAT00000027216 ; EP400-201; exon 18
Database links

Mature sequence bta-miR-6520

Accession MIMAT0025538
Sequence

11 - 

uugaguauugucagagagagc

 - 31

Get sequence
Deep sequencing98 reads, 47 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).