Stem-loop sequence bta-mir-6519

AccessionMI0022281 (change log)
DescriptionBos taurus miR-6519 stem-loop
Stem-loop
   ucccuagcucuucugccuccugugaaucucucaguc        -    aguu    cc 
5'                                     uucuuugu ccug    uuag  g
                                       |||||||| ||||    ||||   
3'                                     aagagaca gggc    gauc  u
   -------------------------aucgaucugaa        a    -gac    aa 
Get sequence
Deep sequencing
140 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 85091650-85091742 [-]
intergenic
Database links

Mature sequence bta-miR-6519

Accession MIMAT0025537
Sequence

64 - 

uagcagcgggaacagagaaa

 - 83

Get sequence
Deep sequencing140 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).