Stem-loop sequence bta-mir-6518

AccessionMI0022280 (change log)
DescriptionBos taurus miR-6518 stem-loop
Stem-loop
   c  a     ucagcauuuauuuc                      g c 
5'  ug ggguc              gcaguuucuccucuccgugagc u u
    || |||||              |||||||||||||||||||||| | g
3'  ac cccgg              cgucaaagaggagaggcacucg a c
   a  -     ----------ucca                      g c 
Get sequence
Deep sequencing
94 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 43107056-43107143 [+]
antisense
ENSBTAT00000028036 ; bta-mir-6518-201; 3'UTR (exon 5)
Database links

Mature sequence bta-miR-6518

Accession MIMAT0025536
Sequence

57 - 

ucacggagaggagaaacugcac

 - 78

Get sequence
Deep sequencing93 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).