Stem-loop sequence bta-mir-378b

AccessionMI0022279 (change log)
DescriptionBos taurus miR-378b stem-loop
Gene family MIPF0000168; mir-378
Literature search

24 open access papers mention bta-mir-378b
(101 sentences)

Stem-loop
   cuggaccaccagggaaauccuga     u    -ua     ---g gag    ag 
5'                        uuuug uucu   uuaag    g   guuc  u
                          ||||| ||||   |||||    |   ||||   
3'                        aagac gagg   aguuc    c   cgag  a
   ----------aaccuggauucgg     u    uuc     acga aaa    au 
Get sequence
Deep sequencing
742463 reads, 6.13e+03 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 30904740-30904837 [+]
intergenic
Database links

Mature sequence bta-miR-378b

Accession MIMAT0025535
Sequence

67 - 

acuugacuuggagucagaaggc

 - 88

Get sequence
Deep sequencing742440 reads, 78 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).