Stem-loop sequence bta-mir-2284y-2

AccessionMI0022277 (change log)
DescriptionBos taurus miR-2284y-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284y-2
(33 sentences)

Stem-loop
   -  -   a       a        g            ag 
5'  gg guu gccaaaa guucguuc gguuuuucugua  a
    || ||| ||||||| |||||||| ||||||||||||   
3'  cc caa cgguuuu caaguaag uuaaaaagacau  u
   a  g   c       a        g            gg 
Get sequence
Deep sequencing
71458 reads, 429 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 73356056-73356133 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2284y-2
bta-mir-2284y-2chr13: 73356056-73356133 [-]
bta-mir-2285uchr13: 73356047-73356147 [+]
Database links

Mature sequence bta-miR-2284y

Accession MIMAT0024579
Sequence

11 - 

aaaaguucguucggguuuuuc

 - 31

Get sequence
Deep sequencing491587 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).