Stem-loop sequence bta-mir-2285m-2

AccessionMI0022276 (change log)
DescriptionBos taurus miR-2285m-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285m-2
(15 sentences)

Stem-loop
   ac   cua    c             g      aaua     
5'   ugg   ggcc aaaaguucauuug guuuuc    guau 
     |||   |||| ||||||||||||| ||||||    ||| c
3'   acc   ccgg uuuucaaguaaac caaaag    cauu 
   ua   uaa    u             g      --ga     
Get sequence
Deep sequencing
526 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 47283643-47283723 [-]
antisense
ENSBTAT00000015282 ; DIP2C-201; intron 7
Database links

Mature sequence bta-miR-2285m

Accession MIMAT0025533
Sequence

50 - 

aaaacgcaaaugaacuuuuugg

 - 71

Get sequence
Deep sequencing610 reads, 62 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).