Stem-loop sequence bta-mir-2285n-1

AccessionMI0022272 (change log)
DescriptionBos taurus miR-2285n-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285n-1
(15 sentences)

Stem-loop
   c        a       a      c c   g     auaag 
5'  acuggguu gccaaaa guucgu c ggu uuucc     a
    |||||||| ||||||| |||||| | ||| |||||      
3'  ugacccaa cgguuuu caagua g cca aaagg     u
   -        c       -      a c   a     caaug 
Get sequence
Deep sequencing
1470 reads, 26.4 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 80695473-80695554 [-]
intergenic
Database links

Mature sequence bta-miR-2285n

Accession MIMAT0025531
Sequence

51 - 

aaaaacccgaaugaacuuuugg

 - 72

Get sequence
Deep sequencing24101 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).