Stem-loop sequence bta-mir-2285o-2

AccessionMI0022271 (change log)
DescriptionBos taurus miR-2285o-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285o-2
(15 sentences)

Stem-loop
   a           a   u  c a     -a       uuuac 
5'  uuggguuggcc aaa gu u uuugg  uuuuucc     g
    ||||||||||| ||| || | |||||  |||||||      
3'  aacccaaccgg uuu ca g aagcc  aaaaagg     u
   -           g   u  a c     ca       uaucc 
Get sequence
Deep sequencing
3820 reads, 10.8 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 32383926-32384007 [-]
antisense
ENSBTAT00000024717 ; FLT3-201; intron 18
Database links

Mature sequence bta-miR-2285o

Accession MIMAT0025530
Sequence

53 - 

aaacccgaacgaacuuuugg

 - 72

Get sequence
Deep sequencing17940 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).