Stem-loop sequence bta-mir-3154

AccessionMI0022269 (change log)
DescriptionBos taurus miR-3154 stem-loop
Gene family MIPF0001387; mir-3154
Stem-loop
   aggccccuccuucccagccaca     u    g   --     a gu 
5'                       gcucc gcuc ccc  cugcc c  c
                         ||||| |||| |||  ||||| |  a
3'                       cgagg ugag ggg  gacgg g  a
   ---------cccaggggaaaga     c    -   aa     a aa 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 99127964-99128048 [-]
antisense
ENSBTAT00000032743 ; DNM1-201; intron 15
Clustered miRNAs
< 10kb from bta-mir-3154
bta-mir-3154chr11: 99127964-99128048 [-]
bta-mir-3604-2chr11: 99127781-99127853 [+]
bta-mir-199bchr11: 99127762-99127861 [-]
Database links

Mature sequence bta-miR-3154

Accession MIMAT0025529
Sequence

55 - 

cagaaggggagucggagcaga

 - 75

Get sequence
Deep sequencing13 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).