Stem-loop sequence bta-mir-6517

AccessionMI0022268 (change log)
DescriptionBos taurus miR-6517 stem-loop
Stem-loop
   -     ggu  u    gu   u   c   uc    uacucg 
5'  ccgcc   uc cagg  ccg gag ucc  ggcg      g
    |||||   || ||||  ||| ||| |||  ||||      a
3'  ggcgg   ag gucc  ggc cuc agg  ccgc      g
   a     --a  -    ug   -   a   --    uuacaa 
Get sequence
Deep sequencing
686 reads, 3.08 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 42866714-42866791 [+]
antisense
ENSBTAT00000044951 ; bta-mir-6517-201; exon 1
Database links

Mature sequence bta-miR-6517

Accession MIMAT0025528
Sequence

11 - 

ucaggguccgugagcuccucggc

 - 33

Get sequence
Deep sequencing667 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).