Stem-loop sequence han-MIR156c

AccessionMI0022236
DescriptionHelianthus annuus miR156c stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   -augu         -           ag  a  ca         cau 
5'      ugacagaag auagagagcac  ag ag  ugaauugca   a
        ||||||||| |||||||||||  || ||  |||||||||   g
3'      acugucuuc uaucucucgug  uc uc  acuuaacgu   a
   ccauu         g           cu  c  --         uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence han-miR156c

Accession MIMAT0025496
Sequence

4 - 

uugacagaagauagagagcac

 - 24

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).