Stem-loop sequence har-MIR156c

AccessionMI0022235
DescriptionHelianthus argophyllus miR156c stem-loop
Stem-loop
   a   u     ---------   -    aagagagggagcauagauuccuuuauuuagguuuuc 
5'  gga aggaa         gug acag                                    c
    ||| |||||         ||| ||||                                    a
3'  ucu uccuu         cac uguc                                    u
   -   -     gaacaaaca   g    gguuuccaaauugguucucuuagguugaauuugguc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence har-miR156c

Accession MIMAT0025495
Sequence

12 - 

ugacagaagagagggagca

 - 30

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).