Stem-loop sequence hpa-MIR156a

AccessionMI0022234
DescriptionHelianthus paradoxus miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ----------    u   u    --  --g     ---     -agaa    -      -a  gu agauggcaccaccggcugcaccacccgagccgguggcggauacccgucacagaacagcuugucauaauugcugcuauuauuauuauuagccucaaaacuaagaaguugcugaugacagacuuuugguggugauguuucgugguugaguuuaaggugugaacccgaacaguuguuaugaaacaggcugaauugcugcuuuccgu 
5'           auga guu gcga  cg   ugaug   augac     gaga gagagc  ca  c                                                                                                                                                                                                           g
             |||| ||| ||||  ||   |||||   |||||     |||| ||||||  ||  |                                                                                                                                                                                                           u
3'           ugcu cga cgcu  gc   acuac   uauug     cucu cuuucg  gu  g                                                                                                                                                                                                           a
   gcggcccccu    u   -    uu  aga     cug     gcauc    u      ga  ug gcuauggagugcacgacgucccgaaaagaggugagugguuccauggugcuacaauguuaagcguucaggugugcacaugguuugugguugagagugcuugggugauaccugcccuuaccaguucacacuucuucuuggguguaugagcugggcccgggauuuugucuuggguauaggucuuaguagaagcccgugguuuuuuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hpa-miR156a

Accession MIMAT0025494
Sequence

23 - 

ugacagaagagagagagcac

 - 42

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).