Stem-loop sequence har-MIR156a

AccessionMI0022233
DescriptionHelianthus argophyllus miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---       a uu   uu  gaa         -    -        u   -------      cc     ua 
5'    aaagaga g  ugg  ga   cugacagaa gaga gugagcac cgc       cggcaa  guaua  g
      ||||||| |  |||  ||   ||||||||| |||| |||||||| |||       ||||||  |||||  a
3'    uuucuuu c  auc  cu   gacugucuu cucu cacucgug gcg       guuguu  cauau  g
   ugc       - uu   --  -gg         u    u        u   uauuaag      cu     ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence har-miR156a

Accession MIMAT0025493
Sequence

23 - 

ugacagaagagagugagcac

 - 42

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).