Stem-loop sequence htu-MIR156a

AccessionMI0022232
DescriptionHelianthus tuberosus miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ----       u    gauag          -   ga        aca       a ug   c   u 
5'     ggaguga aaga     aguugacaga aga  gugagcac   aaggcaa u  uac aau u
       ||||||| ||||     |||||||||| |||  ||||||||   ||||||| |  ||| |||  
3'     ucucauu uucu     ucgacugucu ucu  uacucgug   uuuuguu a  aug uug g
   uuua       c    -----          a   ag        -gg       - gu   -   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence htu-miR156a

Accession MIMAT0025492
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).