Stem-loop sequence hci-MIR156b

AccessionMI0022231
DescriptionHelianthus ciliaris miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ------------------------------------------------------------------------ugaaguacuaggauaggaagugacagaagagagggagcac   u   uuu         uuc 
5'                                                                                                                 aga ucc   auuuaggcu   c
                                                                                                                   ||| |||   |||||||||    
3'                                                                                                                 ucu agg   ugaauuuga   a
   uuuucuucaacauccuccgcaaaucgcccgguguuacuuuccgcuuccuucuuguugagggaccucaaguucuuccuugaacaaacacacgugucgguuuccuaauagguuc   u   --u         ucu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hci-miR156b

Accession MIMAT0025491
Sequence

21 - 

ugacagaagagagggagcac

 - 40

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).