Stem-loop sequence hci-MIR156b

AccessionMI0022231 (change log)
DescriptionHelianthus ciliaris miR156b stem-loop
Gene family MIPF0000008; MIR156
   ------------------------------------------------------------------------ugaaguacuaggauaggaagugacagaagagagggagcac   u   uuu         uuc 
5'                                                                                                                 aga ucc   auuuaggcu   c
                                                                                                                   ||| |||   |||||||||    
3'                                                                                                                 ucu agg   ugaauuuga   a
   uuuucuucaacauccuccgcaaaucgcccgguguuacuuuccgcuuccuucuuguugagggaccucaaguucuuccuugaacaaacacacgugucgguuuccuaauagguuc   u   --u         ucu 
Get sequence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hci-miR156b

Accession MIMAT0025491

21 - 


 - 40

Get sequence
Evidence not experimental


PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).