Stem-loop sequence hci-MIR156a

AccessionMI0022230
DescriptionHelianthus ciliaris miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ------         uu  uugagaa     a       -             -------     uu      u 
5'       aaagagggu  gg       cugac gaagaga gugaguacacgca       ggcaa  guauag g
         |||||||||  ||       ||||| ||||||| |||||||||||||       |||||  ||||||  
3'       uuuuucucg  cc       gacug cuucucu cacucgugugcgu       uuguu  cauauc g
   cucuuu         uu  ------c     c       u             auugagu     cu      a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hci-miR156a

Accession MIMAT0025490
Sequence

22 - 

ugacagaagagagugaguac

 - 41

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).