Stem-loop sequence han-MIR156b

AccessionMI0022229
DescriptionHelianthus annuus miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---------------       a uu   uu  gaa         -    -         g  -------      cu     cg 
5'                aaagaga g  ugg  ga   cugacagaa gaga gugagcaca gc       cggcaa  guaua  g
                  ||||||| |  |||  ||   ||||||||| |||| ||||||||| ||       ||||||  |||||  a
3'                uuucuuu c  auc  cu   gacugucuu cucu cacucgugu cg       guuguu  cauau  g
   uuuuuuuaguugugc       - uu   --  -gg         u    u         g  uauuaag      cu     ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence han-miR156b

Accession MIMAT0025489
Sequence

23 - 

ugacagaagagagugagcac

 - 42

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).