Stem-loop sequence han-MIR156a

AccessionMI0022228
DescriptionHelianthus annuus miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   gauca   au   ua   -        -    -         a    gc g   ug   --   ag 
5'      gau  aga  gaa augacaga agag agugagcac caaa  c aau  uac  cga  u
        |||  |||  ||| |||||||| |||| ||||||||| ||||  | |||  |||  |||   
3'      cua  ucu  cuu uacugucu ucuc ucacucgug guuu  g uua  aug  guu  g
   cucua   au   ua   c        a    g         g    -a -   gu   uu   ca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence han-miR156a

Accession MIMAT0025488
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Evidence not experimental

References

1
PMID:21670966 "Identification of MicroRNAs and their targets in Helianthus" Barozai MY, Baloch IA, Din M Mol Biol Rep. 39:2523-2532(2012).