Stem-loop sequence hsa-mir-6506

Accession MI0022218
Description Homo sapiens miR-6506 stem-loop
Stem-loop 
---ga       g  ac   a         u  ga 
     cugggau uc  uga uaugguguu gu  g
     ||||||| ||  ||| ||||||||| ||   
     gaccuua ag  acu augcuacag ua  u
acaca       g  --   -         u  gu
Get sequence
Deep sequencing
reads, experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 15704887-15704952 [-]
sense
OTTHUMT00000403742 ; KIAA0430-017; 3'UTR (exon 17)
OTTHUMT00000403742 ; KIAA0430-017; 3'UTR (exon 17)
OTTHUMT00000403737 ; KIAA0430-005; exon 18
OTTHUMT00000403737 ; KIAA0430-005; exon 18
OTTHUMT00000252131 ; KIAA0430-001; exon 19
OTTHUMT00000403739 ; KIAA0430-003; exon 19
OTTHUMT00000403740 ; KIAA0430-004; exon 19
OTTHUMT00000252131 ; KIAA0430-001; exon 19
OTTHUMT00000403739 ; KIAA0430-003; exon 19
OTTHUMT00000403740 ; KIAA0430-004; exon 19
ENST00000344181 ; KIAA0430-202; exon 16
ENST00000344181 ; KIAA0430-201; exon 16
ENST00000552553 ; KIAA0430-017; 3'UTR (exon 17)
ENST00000552553 ; KIAA0430-017; 3'UTR (exon 17)
ENST00000540441 ; KIAA0430-005; exon 18
ENST00000321370 ; KIAA0430-201; exon 18
ENST00000540441 ; KIAA0430-005; exon 18
ENST00000396368 ; KIAA0430-001; exon 19
ENST00000548025 ; KIAA0430-003; exon 19
ENST00000551742 ; KIAA0430-004; exon 19
ENST00000396368 ; KIAA0430-001; exon 19
ENST00000548025 ; KIAA0430-003; exon 19
ENST00000551742 ; KIAA0430-004; exon 19
antisense
OTTHUMT00000422502 ; C16orf45-013; intron 4
OTTHUMT00000422502 ; C16orf45-013; intron 4
ENST00000565857 ; C16orf45-013; intron 4
ENST00000565857 ; C16orf45-013; intron 4

Mature sequence hsa-miR-6506-5p

Accession MIMAT0025468
Sequence

2 -  

acugggaugucacugaauauggu

 - 24

Get sequence
Evidence experimental; Solexa [1]

Mature sequence hsa-miR-6506-3p

Accession MIMAT0025469
Sequence

44 -  

ucguaucagagauuccagacac

 - 65

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).