Stem-loop sequence pol-mir-199a-1

AccessionMI0022203 (change log)
DescriptionParalichthys olivaceus miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention pol-mir-199a-1
(2 sentences)

Stem-loop
   --c       u        c   u    guc 
5'    ccagugu cagacuac ugu cauu   a
      ||||||| |||||||| ||| ||||    
3'    gguuaca gucugaug aca gugg   u
   auu       c        -   u    uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-miR-199a-5p

Accession MIMAT0025440
Sequence

1 - 

cccaguguucagacuaccuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-miR-199a-3p

Accession MIMAT0025441
Sequence

40 - 

acaguagucugcacauugguua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1