Stem-loop sequence pol-mir-144

AccessionMI0022201 (change log)
DescriptionParalichthys olivaceus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   g     ----         u        -a    au 
5'  cgggg    auaucaucu auacugua  guuu  u
    |||||    ||||||||| ||||||||  ||||  a
3'  gcccu    uguaguaga uaugacau  caga  u
   -     auca         -        ca    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-miR-144-5p

Accession MIMAT0025436
Sequence

5 - 

ggauaucaucuuauacuguaagu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-miR-144-3p

Accession MIMAT0025437
Sequence

43 - 

uacaguauagaugauguacuau

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1