Stem-loop sequence pol-mir-22

AccessionMI0022196 (change log)
DescriptionParalichthys olivaceus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   ca           -      a      u  ccuca 
5'   gcaguucuuca cuggca gcuuua gu     u
     ||||||||||| |||||| |||||| ||      
3'   ugucaagaagu gaccgu cgaaau ca     g
   --           c      -      -  acuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-miR-22-5p

Accession MIMAT0025426
Sequence

5 - 

aguucuucacuggcaagcuuua

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-miR-22-3p

Accession MIMAT0025427
Sequence

46 - 

aagcugccagcugaagaacugu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1