Stem-loop sequence pol-mir-9b

AccessionMI0022193 (change log)
DescriptionParalichthys olivaceus miR-9b stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention pol-mir-9b
(1 sentences)

Stem-loop
   --uc       a       g      uu 
5'     uuugguu ucuagcu uaugag  u
       ||||||| ||||||| ||||||  u
3'     aagccaa agaucga auacuu  a
   auga       g       a      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-miR-9b-5p

Accession MIMAT0025420
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-miR-9b-3p

Accession MIMAT0025421
Sequence

36 - 

uaaagcuagagaaccgaaagua

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1