Stem-loop sequence ssc-mir-2411

AccessionMI0022164 (change log)
DescriptionSus scrofa miR-2411 stem-loop
Gene family MIPF0001571; mir-2411
Literature search

3 open access papers mention ssc-mir-2411
(9 sentences)

Stem-loop
   ----a    ca      -    ac  u   aug      --   ga 
5'      gagg  augugg agug  ug cag   cagcca  uca  a
        ||||  |||||| ||||  || |||   ||||||  |||  u
3'      cucc  uacacc ucau  ac guc   gucggu  agu  a
   accac    --      c    --  u   -aa      uu   gg 
Get sequence
Deep sequencing
94 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 104285506-104285588 [-]
sense
ENSSSCT00000032077 ; SNORA58.5-201; exon 1
ENSSSCT00000030928 ; SNORA58.4-201; exon 1
chr4: 104403861-104403943 [-]
sense
ENSSSCT00000032077 ; SNORA58.5-201; exon 1
ENSSSCT00000030928 ; SNORA58.4-201; exon 1
Database links

Mature sequence ssc-miR-2411

Accession MIMAT0025389
Sequence

11 - 

uggagugacugucagaugcagc

 - 32

Get sequence
Deep sequencing87 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).