Stem-loop sequence ssc-mir-676-2

AccessionMI0022156 (change log)
DescriptionSus scrofa miR-676-2 stem-loop
Gene family MIPF0000471; mir-676
Literature search

3 open access papers mention ssc-mir-676-2
(3 sentences)

Stem-loop
   ---      u     uu      c     uc    aauu 
5'    aacgcg gacuc  caaucu aggac  gcau    a
      |||||| |||||  |||||| |||||  ||||     
3'    uugcgu uugag  guugga uccug  cgua    g
   ucu      c     uu      a     -c    agac 
Get sequence
Deep sequencing
1053 reads, 26.7 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-676-3p

Accession MIMAT0013943
Previous IDsssc-miR-676
Sequence

46 - 

ccguccuaagguuguugaguu

 - 66

Get sequence
Deep sequencing2106 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).