Stem-loop sequence ssc-mir-582

AccessionMI0022154 (change log)
DescriptionSus scrofa miR-582 stem-loop
Gene family MIPF0000417; mir-582
Literature search

1 open access papers mention ssc-mir-582
(1 sentences)

Stem-loop
   ---        uua             a     uaaucu 
5'    cucuuugg   caguuguucaacc guuac      a
      ||||||||   ||||||||||||| |||||       
3'    gggaaacc   gucaacaaguugg caaug      a
   cgu        caa             c     ucaauc 
Get sequence
Deep sequencing
209 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr16: 41335754-41335830 [+]
sense
ENSSSCT00000020470 ; ssc-mir-582.1-201; exon 1
Database links

Mature sequence ssc-miR-582-5p

Accession MIMAT0037466
Sequence

10 - 

uacaguuguucaaccaguuacu

 - 31

Get sequence
Deep sequencing117 reads, 15 experiments
Evidence experimental; Illumina [2]

Mature sequence ssc-miR-582-3p

Accession MIMAT0025380
Sequence

46 - 

uaaccgguugaacaacugaacc

 - 67

Get sequence
Deep sequencing92 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).