Stem-loop sequence ssc-mir-493

AccessionMI0022152 (change log)
DescriptionSus scrofa miR-493 stem-loop
Gene family MIPF0000230; mir-493
Literature search

3 open access papers mention ssc-mir-493
(6 sentences)

Stem-loop
   --ccc        u                    -   uc u 
5'      cagggccu guacaugguaggcuuucauu cau  g u
        |||||||| |||||||||||||||||||| |||  |  
3'      gucccgga cgugugucaucuggaagugg gua  c u
   accgu        c                    c   ca g 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 132069400-132069482 [-]
sense
ENSSSCT00000019719 ; ssc-mir-493.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-493
ssc-mir-136chr7: 132079194-132079275 [+]
ssc-mir-432chr7: 132079003-132079082 [+]
ssc-mir-493chr7: 132069400-132069482 [-]
Database links

Mature sequence ssc-miR-493-5p

Accession MIMAT0025377
Sequence

11 - 

uuguacaugguaggcuuucauu

 - 32

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-493-3p

Accession MIMAT0025378
Sequence

52 - 

ugaaggucuacugugugccagg

 - 73

Get sequence
Deep sequencing14 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).