Stem-loop sequence ssc-mir-452

AccessionMI0022149 (change log)
DescriptionSus scrofa miR-452 stem-loop
Gene family MIPF0000287; mir-452
Literature search

2 open access papers mention ssc-mir-452
(3 sentences)

Stem-loop
   -          aac g       ag  a       cuu   a 
5'  aagcacuuac   u uuugcag  ga acugaga   ugu a
    ||||||||||   | |||||||  || |||||||   |||  
3'  uucgugaaug   a aaacguc  cu ugacucu   aca c
   a          --a g       aa  c       ---   u 
Get sequence
Deep sequencing
374 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 140861113-140861192 [-]
sense
ENSSSCT00000021034 ; ssc-mir-452.1-201; exon 1
ENSSSCT00000013944 ; GABRE-201; intron 6
Clustered miRNAs
< 10kb from ssc-mir-452
ssc-mir-452chrX: 140861113-140861192 [-]
ssc-mir-224chrX: 140860060-140860140 [-]
Database links

Mature sequence ssc-miR-452

Accession MIMAT0025374
Sequence

11 - 

aacuguuugcagaggaaacuga

 - 32

Get sequence
Deep sequencing283 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).