Stem-loop sequence ssc-mir-363-2

AccessionMI0022147 (change log)
DescriptionSus scrofa miR-363-2 stem-loop
Gene family MIPF0000138; mir-363
Literature search

6 open access papers mention ssc-mir-363-2
(20 sentences)

Stem-loop
   --    u   gu         ca  a         --ga   gu 
5'   uugc guu  cggguggau  cg ugcaauuuu    uua  a
     |||| |||  |||||||||  || |||||||||    |||   
3'   gacg caa  gucuaccua  gc acguuaaaa    gau  u
   ag    c   au         ug  -         agag   ac 
Get sequence
Deep sequencing
264 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-363

Accession MIMAT0015711
Sequence

54 - 

aauugcacgguauccaucuguaa

 - 76

Get sequence
Deep sequencing528 reads, 13 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).