Stem-loop sequence ssc-mir-345-2

AccessionMI0022146 (change log)
DescriptionSus scrofa miR-345-2 stem-loop
Gene family MIPF0000189; mir-345
Literature search

4 open access papers mention ssc-mir-345-2
(5 sentences)

Stem-loop
   --          g u          c   u   ug g u 
5'   acccaggucu c gacuccuagu cag gcu  u a g
     |||||||||| | |||||||||| ||| |||  | |  
3'   uggguccgga g cuggggauca guc cgg  g u g
   uu          g u          a   c   gu g c 
Get sequence
Deep sequencing
482 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-345-5p

Accession MIMAT0013899
Sequence

11 - 

gcugacuccuaguccagugc

 - 30

Get sequence
Deep sequencing88 reads, 9 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-miR-345-3p

Accession MIMAT0013900
Sequence

48 - 

cccugaacuaggggucuggag

 - 68

Get sequence
Deep sequencing792 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).