Stem-loop sequence ssc-mir-217-2

AccessionMI0022142 (change log)
DescriptionSus scrofa miR-217-2 stem-loop
Gene family MIPF0000077; mir-217
Literature search

3 open access papers mention ssc-mir-217-2
(10 sentences)

Stem-loop
   -    c c  a  c     c          u -   aag 
5'  augu g ag ua ugcau aggaacugau g gau   a
    |||| | || || ||||| |||||||||| | |||    
3'  uacg c uc gu acgua uucuugacua c cug   a
   c    a u  c  u     a          c a   guu 
Get sequence
Deep sequencing
225 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-217

Accession MIMAT0002131
Sequence

11 - 

uacugcaucaggaacugauuggau

 - 34

Get sequence
Deep sequencing448 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).